Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1525689
End position: 1525730
Length: 42

DNA sequence
>NC_021663, from 1525689 to 1525730 (42 bp); Corynebacterium terpenotabidum Y-11 CTCAGTGGCTGATGCTCAGAGCCTGATGCTCAGTGCCTGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1525719-1526465	Sequence	A606_06575 - hypothetical protein (Protein is coded in complementary strand; from 1526465 to 1525719)