Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1432996
End position: 1433040
Length: 45

DNA sequence
>NC_021663, from 1432996 to 1433040 (45 bp); Corynebacterium terpenotabidum Y-11 TCTGGTTCTGTCGTGCCTGATTCTGTTGTGCCTGGTTCTCTCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1432980-1433561	Sequence	A606_06135 ruvC Holliday junction resolvase (Protein is coded in complementary strand; from 1433561 to 1432980)