Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1516753
End position: 1516797
Length: 45

DNA sequence
>NC_021663, from 1516753 to 1516797 (45 bp); Corynebacterium terpenotabidum Y-11 CGGTCACCGCCACCGCGGTTGCCGCCACCCCGGTTAGCGCCACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1514983-1517097	Sequence	A606_06530 - hypothetical protein (Protein is coded in complementary strand; from 1517097 to 1514983)