Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1542095
End position: 1542139
Length: 45

DNA sequence
>NC_021663, from 1542095 to 1542139 (45 bp); Corynebacterium terpenotabidum Y-11 CTGCGCAGCCTCCCGCACAGCAGCCTCCCGCACAGCAGCCTCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1542087-1543265	Sequence	A606_06645 - hypothetical protein (Protein is coded in complementary strand; from 1543265 to 1542087)