Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2378640
End position: 2378684
Length: 45

DNA sequence
>NC_021663, from 2378640 to 2378684 (45 bp); Corynebacterium terpenotabidum Y-11 GCCGTCTTCTTGGCAGCTGCCTTCTTCGCAGTGGTCTTCTTCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2378634-2381660	Sequence	A606_10395 - DNA topoisomerase I subunit omega (Protein is coded in complementary strand; from 2381660 to 2378634)