Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2491101
End position: 2491145
Length: 45

DNA sequence
>NC_021663, from 2491101 to 2491145 (45 bp); Corynebacterium terpenotabidum Y-11 CCTCCGGTTCCACCTCAGCCCGTTCCACCTCAGCCCGTTCCACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2490152-2492701	Sequence	A606_10815 - hypothetical protein (Protein is coded in complementary strand; from 2492701 to 2490152)