Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 643038
End position: 643082
Length: 45

DNA sequence
>NC_021663, from 643038 to 643082 (45 bp); Corynebacterium terpenotabidum Y-11 CACGGAGGACGCCGCAGGGGAGGACGCCGCAGGGGAGGACGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 642826-644712	Sequence	A606_02745 - acyl-CoA carboxylase subunit alpha (Protein is coded in complementary strand; from 644712 to 642826)