Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1428777
End position: 1428824
Length: 48

DNA sequence
>NC_021663, from 1428777 to 1428824 (48 bp); Corynebacterium terpenotabidum Y-11 CGGTGTCAGTCTCGGTGGCAGGCTCGGTGTCCATCTCGGTGGCAGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1428722-1430593	Sequence	A606_06115 secD preprotein translocase subunit SecD (Protein is coded in complementary strand; from 1430593 to 1428722)