Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2336051
End position: 2336098
Length: 48

DNA sequence
>NC_021663, from 2336051 to 2336098 (48 bp); Corynebacterium terpenotabidum Y-11 GCGCAGCAGTGTGCGCAGCGCTGTGCTCAGCGGTGTGCGCAGCCGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2334763-2336169	Sequence	A606_10225 - hypothetical protein (Protein is coded in complementary strand; from 2336169 to 2334763)