Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1746997
End position: 1747050
Length: 54

DNA sequence
>NC_021663, from 1746997 to 1747050 (54 bp); Corynebacterium terpenotabidum Y-11 GTGTCAGCAGCGTCGGCAGCGTCAGCAGCGTCGGCAGCGTCAGCAGCGTCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1744771-1747563	Sequence	A606_07465 - hypothetical protein (Protein is coded in complementary strand; from 1747563 to 1744771)