Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1914733
End position: 1914786
Length: 54

DNA sequence
>NC_021663, from 1914733 to 1914786 (54 bp); Corynebacterium terpenotabidum Y-11 GCGGCCTCGGTGTCCTCGGTGTCCTCGGTGTCCTCGGTGTCCTCGGTGTCATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1913911-1915269	Sequence	A606_08260 - hypothetical protein (Protein is coded in complementary strand; from 1915269 to 1913911)