Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2327784
End position: 2327837
Length: 54

DNA sequence
>NC_021663, from 2327784 to 2327837 (54 bp); Corynebacterium terpenotabidum Y-11 ACCACAGTGCCCACAGTGTCCACAGCGTCCACAGTGTCCCCAGTGCCCACAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2326488-2327834	Sequence	A606_10180 - two-component system sensor kinase (Protein is coded in complementary strand; from 2327834 to 2326488)