Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2649986
End position: 2650039
Length: 54

DNA sequence
>NC_021663, from 2649986 to 2650039 (54 bp); Corynebacterium terpenotabidum Y-11 CCTCAGCAGCGCCAGCGGCGTCAGCAGCGTCAGCAGCGTCAGCAGCGTCAGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2649946-2651415	Sequence	A606_11510 - hypothetical protein (Protein is coded in complementary strand; from 2651415 to 2649946)