Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1460338
End position: 1460397
Length: 60

DNA sequence
>NC_021663, from 1460338 to 1460397 (60 bp); Corynebacterium terpenotabidum Y-11 CGGGCACAGGCAGGCTCAAGCAGGCTCAAGCAGGCTCCAGCAGGCTCAGGCAGACTCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1460394-1460693	Sequence	A606_06270 - hypothetical protein (Protein is coded in complementary strand; from 1460693 to 1460394)