Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2505137
End position: 2505196
Length: 60

DNA sequence
>NC_021663, from 2505137 to 2505196 (60 bp); Corynebacterium terpenotabidum Y-11 GTCTCAGCGTCGGTCTCCACGTCGGTCTCCACGTCGGTCTCAGCGTCCGTCTCAGTGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2504687-2505424	Sequence	A606_10875 - hypothetical protein (Protein is coded in complementary strand; from 2505424 to 2504687)