Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1179723
End position: 1179785
Length: 63

DNA sequence
>NC_021663, from 1179723 to 1179785 (63 bp); Corynebacterium terpenotabidum Y-11 GGGTGGTGGACCGGTGTAGCCGGGTGGTGGACCGGTGTAGCCGGGTGGTGGGCCGACGTAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1177861-1179825	Sequence	A606_05045 - hypothetical protein (Protein is coded in complementary strand; from 1179825 to 1177861)