Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1546320
End position: 1546346
Length: 27

DNA sequence
>NC_021663, from 1546320 to 1546346 (27 bp); Corynebacterium terpenotabidum Y-11 GGTGCGGGTGGTGCGGGTGGTGCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1545958-1546362	Sequence	A606_06660 - hypothetical protein (Protein is coded in complementary strand; from 1546362 to 1545958)