Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1757752
End position: 1757787
Length: 36

DNA sequence
>NC_021663, from 1757752 to 1757787 (36 bp); Corynebacterium terpenotabidum Y-11 GTCTCGTCTGTGGTGTTGTCTGTGGTCTCGTCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1755736-1757970	Sequence	A606_07495 - hypothetical protein (Protein is coded in complementary strand; from 1757970 to 1755736)