Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1864440
End position: 1864487
Length: 48

DNA sequence
>NC_021663, from 1864440 to 1864487 (48 bp); Corynebacterium terpenotabidum Y-11 GCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1864122-1865282	Sequence	A606_08060 - hypothetical protein (Protein is coded in complementary strand; from 1865282 to 1864122)