Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 1934979
End position: 1935005
Length: 27

DNA sequence
>NC_021663, from 1934979 to 1935005 (27 bp); Corynebacterium terpenotabidum Y-11 TCCGTTGTTTCCGTTATTTCCGTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1934968-1936716	Sequence	A606_08390 - AMP-binding domain protein (Protein is coded in complementary strand; from 1936716 to 1934968)