Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2193684
End position: 2193707
Length: 24

DNA sequence
>NC_021663, from 2193684 to 2193707 (24 bp); Corynebacterium terpenotabidum Y-11 CGACGACGACGCCGGCGAAGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2193020-2194351	Sequence	A606_09535 secY preprotein translocase subunit SecY (Protein is coded in complementary strand; from 2194351 to 2193020)