Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2370832
End position: 2370867
Length: 36

DNA sequence
>NC_021663, from 2370832 to 2370867 (36 bp); Corynebacterium terpenotabidum Y-11 GCGGTCGTCCGGGCGGTCGACCGAGTGGTGGTCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2370430-2371395	Sequence	A606_10355 - hypothetical protein (Protein is coded in complementary strand; from 2371395 to 2370430)