Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2388396
End position: 2388437
Length: 42

DNA sequence
>NC_021663, from 2388396 to 2388437 (42 bp); Corynebacterium terpenotabidum Y-11 CCCAGCGTTCACGGCCCAGCGTTCACGGCCCAGCGTTCACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2388433-2388798	Sequence	A606_10425 - hypothetical protein (Protein is coded in complementary strand; from 2388798 to 2388433)