Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2524442
End position: 2524485
Length: 44

DNA sequence
>NC_021663, from 2524442 to 2524485 (44 bp); Corynebacterium terpenotabidum Y-11 TTTCTACGGCAGTTCTACGGCAGTTCTACGACATTCCTACGACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2524479-2525216	Sequence	A606_10965 - urease accessory protein (Protein is coded in complementary strand; from 2525216 to 2524479)