Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2527405
End position: 2527440
Length: 36

DNA sequence
>NC_021663, from 2527405 to 2527440 (36 bp); Corynebacterium terpenotabidum Y-11 GTGGCCGTGCCCGTGGCCGTGCTCGTGGCCCTGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2527361-2528170	Sequence	A606_10980 - hypothetical protein (Protein is coded in complementary strand; from 2528170 to 2527361)