Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2551731
End position: 2551778
Length: 48

DNA sequence
>NC_021663, from 2551731 to 2551778 (48 bp); Corynebacterium terpenotabidum Y-11 CTCGGTGGCGGCCTCGGTGGCGGTCACGGTGGAGGCCGCGGTGGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2549968-2551824	Sequence	A606_11090 - hypothetical protein (Protein is coded in complementary strand; from 2551824 to 2549968)