Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2596091
End position: 2596126
Length: 36

DNA sequence
>NC_021663, from 2596091 to 2596126 (36 bp); Corynebacterium terpenotabidum Y-11 GTGGCATTGTCTGTGGCATTGTCTGTGGCATTGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2595395-2596303	Sequence	A606_11270 - regulatory protein (Protein is coded in complementary strand; from 2596303 to 2595395)