Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2622588
End position: 2622626
Length: 39

DNA sequence
>NC_021663, from 2622588 to 2622626 (39 bp); Corynebacterium terpenotabidum Y-11 GTCACAACTCCCCGTCACAGCTCCCCGTCACAACTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2622616-2624997	Sequence	A606_11375 - hypothetical protein (Protein is coded in complementary strand; from 2624997 to 2622616)