Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2657128
End position: 2657163
Length: 36

DNA sequence
>NC_021663, from 2657128 to 2657163 (36 bp); Corynebacterium terpenotabidum Y-11 TCGACGGGCTCGACGGGCTCGACGGGCTCGACGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2657098-2658480	Sequence	A606_11545 - hypothetical protein (Protein is coded in complementary strand; from 2658480 to 2657098)