Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2674815
End position: 2674841
Length: 27

DNA sequence
>NC_021663, from 2674815 to 2674841 (27 bp); Corynebacterium terpenotabidum Y-11 GAGCTGCTAGAGCTGCTACAGCTGCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2674840-2675673	Sequence	A606_11610 - hypothetical protein (Protein is coded in complementary strand; from 2675673 to 2674840)