Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2707853
End position: 2707906
Length: 54

DNA sequence
>NC_021663, from 2707853 to 2707906 (54 bp); Corynebacterium terpenotabidum Y-11 CCGTAGCGTCTGCAGCGTCCGCAGCGTCTGCAGCGCCTGCAGCGCCTGCAGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2707807-2708724	Sequence	A606_11730 - rod-shaped morphology protein (Protein is coded in complementary strand; from 2708724 to 2707807)