Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 2732974
End position: 2733009
Length: 36

DNA sequence
>NC_021663, from 2732974 to 2733009 (36 bp); Corynebacterium terpenotabidum Y-11 CTGTCCGGATTCCTGCCCGGATTCCTGCCCGGATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2732268-2732975	Sequence	A606_11860 - hypothetical protein (Protein is coded in complementary strand; from 2732975 to 2732268)
ORF. 2732972-2734531	Sequence	A606_11865 - tRNA nucleotidyltransferase (Protein is coded in complementary strand; from 2734531 to 2732972)