Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 354140
End position: 354163
Length: 24

DNA sequence
>NC_021663, from 354140 to 354163 (24 bp); Corynebacterium terpenotabidum Y-11 GTCCGCGTCCACGACCGCGTCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 354105-354413	Sequence	A606_01435 - hypothetical protein (Protein is coded in complementary strand; from 354413 to 354105)