Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 513684
End position: 513719
Length: 36

DNA sequence
>NC_021663, from 513684 to 513719 (36 bp); Corynebacterium terpenotabidum Y-11 GTCGGCGTGGTCGGCGTGGTCGGCGTGGTCGGCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 513163-514155	Sequence	A606_02165 - ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 514155 to 513163)