Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 56045
End position: 56080
Length: 36

DNA sequence
>NC_021663, from 56045 to 56080 (36 bp); Corynebacterium terpenotabidum Y-11 GCGGTATCGAGGCCGGTATCGAGACCGGTATCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 55187-56092	Sequence	A606_00235 - iron-siderophore binding protein (Protein is coded in complementary strand; from 56092 to 55187)