Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 655930
End position: 655956
Length: 27

DNA sequence
>NC_021663, from 655930 to 655956 (27 bp); Corynebacterium terpenotabidum Y-11 GGTGCCGCTGGAGCCGCTGGTGTCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 655865-656758	Sequence	A606_02800 - glutamine cyclotransferase (Protein is coded in complementary strand; from 656758 to 655865)