Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 728036
End position: 728059
Length: 24

DNA sequence
>NC_021663, from 728036 to 728059 (24 bp); Corynebacterium terpenotabidum Y-11 CCCGGTCCCCCGGTGCACCGGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 727294-728463	Sequence	A606_03090 - hypothetical protein (Protein is coded in complementary strand; from 728463 to 727294)