Sequence retrieval

Genome: Corynebacterium terpenotabidum Y-11
Start position: 986601
End position: 986624
Length: 24

DNA sequence
>NC_021663, from 986601 to 986624 (24 bp); Corynebacterium terpenotabidum Y-11 TCCGCCCCCGCCGCCGCCACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 986569-988659	Sequence	A606_04200 - hypothetical protein (Protein is coded in complementary strand; from 988659 to 986569)