Sequence retrieval

Genome: Acinetobacter baumannii BJAB0868
Start position: 1077372
End position: 1077396
Length: 25

DNA sequence
>NC_021729, from 1077372 to 1077396 (25 bp); Acinetobacter baumannii BJAB0868 TTTTTTTCTTTATTTTTTTATTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1076849-1077865	Sequence	BJAB0868_01008 - hypothetical protein (Protein is coded in complementary strand; from 1077865 to 1076849)