Sequence retrieval

Genome: Acinetobacter baumannii BJAB0868
Start position: 1605873
End position: 1605896
Length: 24

DNA sequence
>NC_021729, from 1605873 to 1605896 (24 bp); Acinetobacter baumannii BJAB0868 ACGAACACGACCACGAAGACGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1604992-1608474	Sequence	BJAB0868_01517 - Indolepyruvate ferredoxin oxidoreductase, alpha and beta subunits (Protein is coded in complementary strand; from 1608474 to 1604992)