Sequence retrieval

Genome: Acinetobacter baumannii BJAB0868
Start position: 193082
End position: 193105
Length: 24

DNA sequence
>NC_021729, from 193082 to 193105 (24 bp); Acinetobacter baumannii BJAB0868 CAAGGTCAAGGTCAAAGTCAATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 192679-194469	Sequence	BJAB0868_00180 - Arginyl-tRNA synthetase (Protein is coded in complementary strand; from 194469 to 192679)