Sequence retrieval

Genome: Acinetobacter baumannii BJAB0868
Start position: 2398268
End position: 2398303
Length: 36

DNA sequence
>NC_021729, from 2398268 to 2398303 (36 bp); Acinetobacter baumannii BJAB0868 TCAGGTTCAGGTTCAGGTTCAGGTTCAGGTTCAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2397494-2399536	Sequence	BJAB0868_02288 - DNA polymerase III, gamma/tau subunits (Protein is coded in complementary strand; from 2399536 to 2397494)