Sequence retrieval

Genome: Acinetobacter baumannii BJAB0868
Start position: 3044382
End position: 3044408
Length: 27

DNA sequence
>NC_021729, from 3044382 to 3044408 (27 bp); Acinetobacter baumannii BJAB0868 CCGCCCATACCACCCATACCGCCCATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3044373-3046007	Sequence	BJAB0868_02879 - Chaperonin GroEL (HSP60 family) (Protein is coded in complementary strand; from 3046007 to 3044373)