Sequence retrieval

Genome: Acinetobacter baumannii BJAB0868
Start position: 3538256
End position: 3538279
Length: 24

DNA sequence
>NC_021729, from 3538256 to 3538279 (24 bp); Acinetobacter baumannii BJAB0868 TTACTATTTTAATATTTTAATATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3538273-3539070	Sequence	BJAB0868_03361 - hypothetical protein (Protein is coded in complementary strand; from 3539070 to 3538273)