Sequence retrieval

Genome: Acinetobacter baumannii BJAB0868
Start position: 3803303
End position: 3803338
Length: 36

DNA sequence
>NC_021729, from 3803303 to 3803338 (36 bp); Acinetobacter baumannii BJAB0868 ATTCTTCTTCATGTTCTTCTTCATAATCATCTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3803251-3806577	Sequence	BJAB0868_03613 - hypothetical protein (Protein is coded in complementary strand; from 3806577 to 3803251)