Sequence retrieval

Genome: Acinetobacter baumannii BJAB0868
Start position: 703116
End position: 703139
Length: 24

DNA sequence
>NC_021729, from 703116 to 703139 (24 bp); Acinetobacter baumannii BJAB0868 AGCAGCAACAGCAGCAGCAACAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 702913-703158	Sequence	BJAB0868_00659 - hypothetical protein (Protein is coded in complementary strand; from 703158 to 702913)