Sequence retrieval

Genome: Acinetobacter baumannii BJAB0868
Start position: 858799
End position: 858828
Length: 30

DNA sequence
>NC_021729, from 858799 to 858828 (30 bp); Acinetobacter baumannii BJAB0868 TGCAGGTGCAGGTGCAGGTGCAGGTGCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 857759-858892	Sequence	BJAB0868_00790 - Multidrug resistance efflux pump (Protein is coded in complementary strand; from 858892 to 857759)