Sequence retrieval

Genome: Acinetobacter baumannii BJAB0868
Start position: 962414
End position: 962473
Length: 60

DNA sequence
>NC_021729, from 962414 to 962473 (60 bp); Acinetobacter baumannii BJAB0868 TTTCTATATGATTTGATTTGATTTGATTTGATTTGATTTGATTTGATTTGATTTGATTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 961936-962520	Sequence	BJAB0868_00887 - hypothetical protein (Protein is coded in complementary strand; from 962520 to 961936)