Sequence retrieval

Genome: Mannheimia haemolytica D171
Start position: 1277284
End position: 1277307
Length: 24

DNA sequence
>NC_021738, from 1277284 to 1277307 (24 bp); Mannheimia haemolytica D171 GCTGCTGCTACTGCTGCCGCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1277041-1277409	Sequence	J450_06105 - 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 1277409 to 1277041)