Sequence retrieval

Genome: Mannheimia haemolytica D171
Start position: 1265165
End position: 1265189
Length: 25

DNA sequence
>NC_021738, from 1265165 to 1265189 (25 bp); Mannheimia haemolytica D171 AATGAAATGCACTGAAATGCAGTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1265114-1265389	Sequence	J450_06045 - hypothetical protein (Protein is coded in complementary strand; from 1265389 to 1265114)